Module eremitalpa.eremitalpa

Functions

def add_sequences_to_tree(tree: dendropy.datamodel.treemodel._tree.Tree,
path: str,
labeller:  | None = None,
seq_formatter:  | None = None) ‑> None

Add sequences to leaves inplace.

Args

tree
Dendropy tree.
path
Path to multiple sequence alignment. Taxon labels in tree must match the fasta description.
labeller

Function that takes a FASTA description and returns the name of associated taxon in the tree. For instance, a full fasta description might look like:

>cdsUUB77424 A/Maryland/12786/2022 2022/04/07 HA

RAxML would call this taxon just 'cdsUUB77424'. So the callable would have to be something like: lambda x: x.split()[0]

seq_formatter

def color_stack(tree: Tree,
values: dict[str, typing.Any],
color_dict: dict[str, str],
default_color: str | None = None,
x: float = 0,
ax: matplotlib.axes._axes.Axes | None = None,
leg_kwds: dict | None = None) ‑> tuple[matplotlib.axes._axes.Axes, matplotlib.legend.Legend]

A stack of colored patches that can be plotted adjacent to a tree to show how values vary on the tree leaves.

Must have called eremitalpa.compute_layout on the tree in order to know y values for leaves (done anyway by eremitalpa.plot_tree).

Args

tree
The tree to be plotted next to.
values
Maps taxon labels to values to be plotted.
color_dict
Maps values to colors.
default_color
Color to use for values missing from color_dict.
x
The x value to plot the stack at.
ax
Matplotlib ax
def compare_trees(left,
right,
gap=0.1,
x0=0,
connect_kwds={},
extend_kwds={},
extend_every=10,
left_kwds={},
right_kwds={},
connect_colors={},
extend_colors={})

Plot two phylogenies side by side, and join the same taxa in each tree.

Args

left (dendropy Tree)
right (dendropy Tree)
gap : float
Space between the two trees.
x0 : float
The x coordinate of the root of the left hand tree.
connect_kwds : dict
Keywords passed to matplotlib LineCollection. These are used for the lines that connect matching taxa.
extend_kwds : dict
Keywords passed to matplotlib LineCollection. These are used for lines that connect taxa to the connection lines.
extend_every : n
Draw branch extension lines every n leaves.
left_kwds : dict
Passed to plot_tree for the left tree.
right_kwds : dict
Passed to plot_tree for the right tree.
connect_colors : dict or Callable
Maps taxon labels to colors. Ignored if 'colors' is used in connect_kwds.
extend_colors : dict or Callable
Maps taxon labels to colors. Ignored if 'colors' is used in extend_kwds.

Returns

(2-tuple) containing dendropy Trees with _x and _y plot locations on nodes.

def compute_tree_layout(tree: dendropy.datamodel.treemodel._tree.Tree,
has_brlens: bool = True,
copy: bool = False,
round_brlens: int | None = None) ‑> dendropy.datamodel.treemodel._tree.Tree

Computes layout parameters for a tree.

Each node gets _x and _y values. The tree gets _xlim and _ylim values (tuples).

Args

tree : dp.Tree
The tree to lay out.
has_brlens : bool
Whether the tree has branch lengths.
copy : bool
If True, a fresh copy of the tree is made.
round_brlens : int, optional
The number of digits to round branch lengths to. Defaults to None.

Returns

dp.Tree
The tree with layout parameters.
def deepest_leaf(tree, attr='_x')

Find the deepest leaf node in the tree.

Args

tree (dendropy Tree)
attr : str
Either _x or _y. Gets node with max attribute.

Returns

dendropy Node

def estimate_unit_branch_length(branch_lengths: list[float], min_diff: float = 1e-06, round_to: int = 6) ‑> float

Estimates the fundamental unit length in a set of phylogenetic branch lengths. Assumes that branch lengths occur in approximate integer multiples of a small unit. Algorithm:

1. Compute all pairwise absolute differences between branch lengths.
2. Construct a histogram of these differences with an adaptive bin size.
3. Identify the most common small difference (mode of the histogram),
which represents the estimated unit length.

Args

branch_lengths : list or np.array
A list of branch lengths.
min_diff : float
Minimum difference between branch lengths to consider. Branch length differences smaller than this value are considered to be zero.
round_to : int
Round branch_lengths to this many decimal places.

Returns

float
Estimated fundamental unit length.
def get_label(node: dendropy.datamodel.treemodel._node.Node)

Gets the label of a node.

If the node itself has a label, that is returned. Otherwise, the label of the node's taxon is returned.

Args

node : dp.Node
The node to get the label from.

Returns

str
The label of the node.
def get_trunk(tree, attr='_x')

Ordered nodes in tree, from deepest leaf to root.

Args

tree (dendropy Tree) attr (str)

Returns

tuple containing dendropy Nodes

def node_x_y(nodes: Iterable[dendropy.datamodel.treemodel._node.Node],
jitter_x: float | None = None) ‑> tuple[tuple, tuple]

Gets the x and y coordinates of nodes.

Args

nodes : Iterable[dp.Node]
An iterable of dendropy Node objects.
jitter_x : float, optional
The amount of jitter to add to the x coordinates. X is jittered by a quarter of this value in both directions. Defaults to None.

Returns

tuple[tuple, tuple]
A tuple containing two tuples: one for x coordinates and one for y coordinates.
def node_x_y_from_taxon_label(tree: Tree,
taxon_label: str) ‑> tuple[float, float]

Finds the x and y attributes of a node from its taxon label.

Args

tree : Tree
The tree to search in.
taxon_label : str
The taxon label of the node.

Returns

tuple[float, float]
The x and y coordinates of the node.
def plot_leaves_with_labels(tree: dendropy.datamodel.treemodel._tree.Tree,
labels: list[str],
ax: matplotlib.axes._axes.Axes = None,
**kwds)

Plots leaves that have taxon labels in a given list.

Args

tree : dp.Tree
The tree to plot.
labels : list[str]
A list of taxon labels to plot.
ax : mp.axes.Axes, optional
The matplotlib axes to plot on. Defaults to None.
**kwds
Additional keyword arguments passed to plt.scatter.
def plot_path_to_taxon(tree: dendropy.datamodel.treemodel._tree.Tree | Tree,
taxon_label: str,
ax: matplotlib.axes._axes.Axes | None = None,
label_taxon: bool = True,
label_kwds: dict | None = None,
**kwds) ‑> matplotlib.collections.LineCollection

Plots the path from the root to a given taxon.

Args

tree : dp.Tree | Tree
The tree to plot.
taxon_label : str
The taxon label of the node to plot the path to.
ax : mp.axes.Axes, optional
The matplotlib axes to plot on.
label_taxon : bool
If True, label the taxon at the end of the path.
label_kwds : dict, optional
Keyword arguments passed to plt.text.

Returns

mp.collections.LineCollection

def plot_subs_on_tree(tree: dendropy.datamodel.treemodel._tree.Tree,
sequences: dict[str, str],
exclude_leaves: bool = True,
on_path_to_taxon: str | None = None,
site_offset: int = 0,
ignore_chars: str = 'X-',
arrow_length: float = 40,
arrow_facecolor: str = 'black',
fontsize: float = 6,
xytext_transform: tuple[float, float] = (1.0, 1.0),
**kwds) ‑> collections.Counter

Plots substitutions on a tree.

This function plots substitutions on the tree by finding substitutions between each node and its parent node. The substitutions are then plotted at the midpoint of the edge between the node and its parent.

Args

tree : dp.Tree
The tree to annotate.
sequences : dict[str, str]
A mapping of node labels to sequences.
exclude_leaves : bool
If True, exclude leaves from substitution plotting.
on_path_to_taxon : str, optional
If provided, only plot substitutions on the path from the root to this taxon. Defaults to None.
site_offset : int
Value to add to substitution site numbers.
ignore_chars : str
Substitutions involving these characters will not be shown.
arrow_length : float
The length of the arrow pointing to the mutation.
arrow_facecolor : str
The face color of the arrow.
fontsize : float
The font size of the text.
xytext_transform : tuple[float, float]
Multipliers for the xytext offsets.
**kwds
Other keyword arguments passed to plt.annotate.

Returns

Counter
A counter of the number of times each substitution appears in the tree.
def plot_tree(tree: dendropy.datamodel.treemodel._tree.Tree | Tree,
has_brlens: bool = True,
edge_kwds: dict = {'color': 'black', 'linewidth': 0.5, 'clip_on': False, 'capstyle': 'round', 'zorder': 10},
leaf_kwds: dict = {'zorder': 15, 'color': 'black', 's': 0, 'marker': 'o', 'edgecolor': 'white', 'lw': 0.1, 'clip_on': False},
internal_kwds: dict = {'zorder': 12, 'color': 'black', 's': 0, 'marker': 'o', 'edgecolor': 'white', 'lw': 0.1, 'clip_on': False},
ax: matplotlib.axes._axes.Axes = None,
labels: Iterable[str] | Literal['all'] | None = None,
label_kwds: dict = {'horizontalalignment': 'left', 'verticalalignment': 'center', 'fontsize': 8, 'zorder': 15},
label_x_offset: float = 0.0,
compute_layout: bool = True,
fill_dotted_lines: bool = False,
round_brlens: int | None = None,
color_leaves_by_site_aa: int | None = None,
hide_aa: str | None = None,
color_internal_nodes_by_site_aa: int | None = None,
sequences: dict[str, str] | None = None,
jitter_x: float | str | None = None,
scale_bar: bool | None = True,
scale_bar_x_start: float = 0.0) ‑> matplotlib.axes._axes.Axes

Plots a dendropy tree object.

Tree nodes are plotted in their current order. To ladderize, call tree.ladderize() before plotting.

Args

tree : dp.Tree | Tree
The tree to plot.
has_brlens : bool
If False, all branch lengths are plotted as 1.
edge_kwds : dict
Keyword arguments for edges, passed to matplotlib.collections.LineCollection.
leaf_kwds : dict
Keyword arguments for leaves, passed to ax.scatter.
label_kwds : dict
Keyword arguments passed to plt.text.
internal_kwds : dict
Keyword arguments for internal nodes, passed to ax.scatter.
ax : mp.axes.Axes, optional
The matplotlib axes to plot on. Defaults to None.
labels (Optional[Union[Iterable[str], Literal["all"]]]): Taxon labels
to annotate, or "all".
label_kwds : dict
Keyword arguments passed to plt.text.
leaf_label_x_offset : float
Amount to offset leaf labels in the x direction.
compute_layout : bool
If True, compute the layout. If False, assumes the tree nodes already have _x and _y attributes.
fill_dotted_lines : bool
If True, show dotted lines from leaves to the right-hand edge of the tree.
round_brlens : int, optional
The number of decimal places to round branch lengths to. Passed to compute_tree_layout().
color_leaves_by_site_aa : int, optional
Color leaves by the amino acid at this site (1-based). Overwrites 'c' in leaf_kwds. Requires sequences.
hide_aa : str, optional
A string of amino acids to hide when coloring by site.
color_internal_nodes_by_site_aa : int, optional
Same as color_leaves_by_site_aa but for internal nodes.
sequences : dict[str, str], optional
A mapping of taxon labels to sequences. Required for coloring by site.
jitter_x : float | str, optional
Amount of noise to add to the x value of leaves to avoid overplotting. Can be a float or 'auto'.
scale_bar : bool
If True, show a scale bar.
scale_bar_x_start : float
The leftmost x position of the scale bar.

Returns

mp.axes.Axes
The matplotlib axes with the plotted tree. The tree object is returned with added attributes: _xlim, _ylim, and _x, _y on each node.
def plot_tree_interactive(tree: dendropy.datamodel.treemodel._tree.Tree,
has_brlens: bool = True,
leaf_colors: dict | None = None,
default_leaf_color: str = 'black',
leaf_sizes: dict | None = None,
default_leaf_size: int = 5)

Plots a dendropy tree object interactively using plotly.

Args

tree : dp.Tree
The tree to plot.
has_brlens : bool
If False, all branch lengths are plotted as 1.
leaf_colors : dict, optional
A dictionary mapping taxon labels to colors.
default_leaf_color : str
The default color for taxa not in leaf_colors.
leaf_sizes : dict, optional
A dictionary mapping taxon labels to sizes.
default_leaf_size : int
The default size for taxa not in leaf_sizes.
def plot_tree_with_subplots(tree: Tree,
aa_seqs: dict,
site: int,
subplot_taxa_shifts: dict[str, tuple[float, float]],
fun: Callable,
fun_kwds: dict | None = None,
subplot_width: float = 0.2,
subplot_height: float = 0.1,
figsize: tuple[float, float] = (8, 12),
sharex: bool = True,
sharey: bool = True,
snap_x: float | None = None,
snap_y: float | None = None,
arrow_origins: dict[str, tuple[float, float]] | None = None,
**kwds) ‑> matplotlib.axes._axes.Axes

Plot a phylogeny tree with subplots for specified taxa.

This function draws a phylogeny based on a given tree and amino acid sequences. It colors leaves (and internal nodes) according to their amino acid at a specified site, and attaches additional subplots at user-defined nodes for further custom visualization.

Args

tree
eremitalpa.Tree The phylogenetic tree to be plotted.
aa_seqs
dict A dictionary containing amino acid sequences for each taxon. Keys should match the node names in the tree, and values should be the sequences.
site
int The site (1-based) to color the tree's leaves and internal nodes.
subplot_taxa_shifts
dict of str -> tuple of float A mapping from taxon names to tuples (dx, dy). These values control the position of the subplot axes relative to their respective nodes. Uses axes coordinates (i.e. a value of 1 would shift an entire ax worth of distance).
fun
Callable A callable function to generate each subplot. Must accept the current taxon as the first argument and an axes object as the second argument.
fun_kwds
dict A dictionary of additional keyword arguments passed to the subplot function fun.
subplot_width
float, optional The width of each subplot in figure coordinates, by default 0.2.
subplot_height
float, optional The height of each subplot in figure coordinates, by default 0.1.
figsize
tuple of float, optional The overall size of the figure, by default (8, 12).
sharex
bool, Have the sub axes share x-axes.
sharey
bool, Have the sub axes share y-axes.
snap_x
float, Snap x position of the subplots to a grid. This argument sets the grid size.
snap_y
float, Snap y position of the subplots to a grid. This argument sets the grid size.
arrow_origins
dict of str -> tuple of float. Pass the axes coordinates of each subplot for where its arrow should originate. By default arrows originate from the center.
**kwds
Passed to plot_tree.

Returns

2-tuple containing: matplotlib.axes.Axes - the main axes. dict [str, matplotlib.axes.Axes] containing sub plots.

def prune_nodes_with_labels(tree, labels)

Prune nodes from tree that have a taxon label in labels.

Args

tree (dendropy Tree) labels (iterable containing str)

Returns

(dendropy Tree)

def read_iqtree_ancestral_states(state_file,
partition_names: list[str] | None = None,
translate_nt: bool = False) ‑> dict[slice(, dict[str, str], None)] | dict[slice(, None)]

Read an ancestral state file generated by IQ-TREE. If the file contains multiple partitions (i.e. a 'Part' column is present), then return a dict of dicts containing sequences accessed by [partition][node]. Otherwise return a dict of sequences accessed by node.

Args

state_file
Path to .state file generated by iqtree –ancestral
partition_names
Partitions are numbered from 1 in the .state file. Pass names for each segment (i.e. the order that partition_names appear in the partitions). Only takes effect if multiple partitions are present.
translate_nt
If ancestral states are nucleotide sequences then translate them.

Returns

dict of dicts that maps [node][partition] -> sequence, or dict that maps node -> sequence.

def read_raxml_ancestral_sequences(tree, node_labelled_tree, ancestral_seqs, leaf_seqs=None)

Read a tree and ancestral sequences estimated by RAxML.

RAxML can estimate marginal ancestral sequences for internal nodes on a tree using a call like:

raxmlHPC -f A -t {treeFile} -s {sequenceFile} -m {model} -n {name}

The analysis outputs several files:

  • RAxML_nodeLabelledRootedTree.{name} contains a copy of the input tree where all internal nodes have a unique identifier {id}.
  • RAxML_marginalAncestralStates.{name} contains the ancestral sequence for each internal node. The format of each line is '{id} {sequence}'
  • RAxML_marginalAncestralProbabilities.{name} contains probabilities of each base at each site for each internal node. (Not used by this function.)

Notes

Developed with output from RAxML version 8.2.12.

Args

tree : str
Path to original input tree ({treeFile}).
node_labelled_tree : str
Path to the tree with node labels. (RAxML_nodeLabelledRootedTree.{name})
ancestral_seqs : str
Path to file containing the ancestral sequences. (RAxML_marginalAncestralStates.{name})
leaf_seqs : str
(Optional) path to fasta file containing leaf sequences. ({sequenceFile}). If this is provided, also attach sequences to leaf nodes.

Returns

(dendropy Tree) with sequences attached to nodes. Sequences are attached as 'sequence' attributes on Nodes.

def snap(value: float, grid_size: float) ‑> float

Find the closest point on a grid for a value.

def sorted_leaf_labels(node)

Tuple containing the sorted leaf labels of a node.

def taxon_in_node_label(label, node)

Checks if a node has a matching taxon label.

Args

label : str
The label to check for.
node : dp.Node
The node to check.

Returns

bool
True if the node's taxon label matches, False otherwise.
def taxon_in_node_labels(labels, node)

Checks if a node's taxon label is in a set of labels.

Args

labels : iterable
A collection of labels to check against.
node : dp.Node
The node to check.

Returns

bool
True if the node's taxon label is in the labels, False otherwise.

Classes

class Column (site, aas)

Column(site, aas)

Ancestors

  • builtins.tuple

Instance variables

var aas

Alias for field number 1

var site

Alias for field number 0

class MultipleSequenceAlignment (records, alphabet=None, annotations=None, column_annotations=None)

Represents a classical multiple sequence alignment (MSA).

By this we mean a collection of sequences (usually shown as rows) which are all the same length (usually with gap characters for insertions or padding). The data can then be regarded as a matrix of letters, with well defined columns.

You would typically create an MSA by loading an alignment file with the AlignIO module:

>>> from Bio import AlignIO
>>> align = AlignIO.read("Clustalw/opuntia.aln", "clustal")
>>> print(align)
Alignment with 7 rows and 156 columns
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191
TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191

In some respects you can treat these objects as lists of SeqRecord objects, each representing a row of the alignment. Iterating over an alignment gives the SeqRecord object for each row:

>>> len(align)
7
>>> for record in align:
...     print("%s %i" % (record.id, len(record)))
...
gi|6273285|gb|AF191659.1|AF191 156
gi|6273284|gb|AF191658.1|AF191 156
gi|6273287|gb|AF191661.1|AF191 156
gi|6273286|gb|AF191660.1|AF191 156
gi|6273290|gb|AF191664.1|AF191 156
gi|6273289|gb|AF191663.1|AF191 156
gi|6273291|gb|AF191665.1|AF191 156

You can also access individual rows as SeqRecord objects via their index:

>>> print(align[0].id)
gi|6273285|gb|AF191659.1|AF191
>>> print(align[-1].id)
gi|6273291|gb|AF191665.1|AF191

And extract columns as strings:

>>> print(align[:, 1])
AAAAAAA

Or, take just the first ten columns as a sub-alignment:

>>> print(align[:, :10])
Alignment with 7 rows and 10 columns
TATACATTAA gi|6273285|gb|AF191659.1|AF191
TATACATTAA gi|6273284|gb|AF191658.1|AF191
TATACATTAA gi|6273287|gb|AF191661.1|AF191
TATACATAAA gi|6273286|gb|AF191660.1|AF191
TATACATTAA gi|6273290|gb|AF191664.1|AF191
TATACATTAA gi|6273289|gb|AF191663.1|AF191
TATACATTAA gi|6273291|gb|AF191665.1|AF191

Combining this alignment slicing with alignment addition allows you to remove a section of the alignment. For example, taking just the first and last ten columns:

>>> print(align[:, :10] + align[:, -10:])
Alignment with 7 rows and 20 columns
TATACATTAAGTGTACCAGA gi|6273285|gb|AF191659.1|AF191
TATACATTAAGTGTACCAGA gi|6273284|gb|AF191658.1|AF191
TATACATTAAGTGTACCAGA gi|6273287|gb|AF191661.1|AF191
TATACATAAAGTGTACCAGA gi|6273286|gb|AF191660.1|AF191
TATACATTAAGTGTACCAGA gi|6273290|gb|AF191664.1|AF191
TATACATTAAGTATACCAGA gi|6273289|gb|AF191663.1|AF191
TATACATTAAGTGTACCAGA gi|6273291|gb|AF191665.1|AF191

Note - This object does NOT attempt to model the kind of alignments used in next generation sequencing with multiple sequencing reads which are much shorter than the alignment, and where there is usually a consensus or reference sequence with special status.

Initialize a new MultipleSeqAlignment object.

Arguments: - records - A list (or iterator) of SeqRecord objects, whose sequences are all the same length. This may be an empty list. - alphabet - For backward compatibility only; its value should always be None. - annotations - Information about the whole alignment (dictionary). - column_annotations - Per column annotation (restricted dictionary). This holds Python sequences (lists, strings, tuples) whose length matches the number of columns. A typical use would be a secondary structure consensus string.

You would normally load a MSA from a file using Bio.AlignIO, but you can do this from a list of SeqRecord objects too:

>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> from Bio.Align import MultipleSeqAlignment
>>> a = SeqRecord(Seq("AAAACGT"), id="Alpha")
>>> b = SeqRecord(Seq("AAA-CGT"), id="Beta")
>>> c = SeqRecord(Seq("AAAAGGT"), id="Gamma")
>>> align = MultipleSeqAlignment([a, b, c],
...                              annotations={"tool": "demo"},
...                              column_annotations={"stats": "CCCXCCC"})
>>> print(align)
Alignment with 3 rows and 7 columns
AAAACGT Alpha
AAA-CGT Beta
AAAAGGT Gamma
>>> align.annotations
{'tool': 'demo'}
>>> align.column_annotations
{'stats': 'CCCXCCC'}

Ancestors

  • Bio.Align.MultipleSeqAlignment

Methods

def plot(self,
ax: matplotlib.axes._axes.Axes | None = None,
fontsize: int = 6,
variable_sites_kwds: dict | None = None,
rotate_xtick_labels: bool = False,
sites: Iterable[int] | None = None) ‑> matplotlib.axes._axes.Axes

Plot variable sites in the alignment.

Args

ax
Matplotlib ax.
fontsize
Fontsize of the character labels.
variable_sites_kwds
Passed to MultipleSequenceAlignment.variable_sites.
rotate_xtick_labels
Rotate the xtick labels 90 degrees.
sites
Only plot these sites. (Note: Only variable sites are plotted, so if a site is passed in this argument but it is not variable it will not be displayed.)
def variable_sites(self, min_2nd_most_freq: int = 1) ‑> Generator[Column, None, None]

Generator for variable sites in the alignment.

Args

min_2nd_most_freq
Used to filter out sites that have low variability. For instance if min_2nd_most_freq is 2 a column containing 'AAAAT' should be excluded because the second most frequent character (T) has a frequency of 1.
class Tree (*args, **kwargs)

An arborescence, i.e. a fully-connected directed acyclic graph with all edges directing away from the root and toward the tips. The "root" of the tree is represented by the :attr:Tree.seed_node attribute. In unrooted trees, this node is an algorithmic artifact. In rooted trees this node is semantically equivalent to the root.

The constructor can optionally construct a |Tree| object by cloning another |Tree| object passed as the first positional argument, or out of a data source if stream and schema keyword arguments are passed with a file-like object and a schema-specification string object values respectively.

Parameters

*args : positional argument, optional If given, should be exactly one |Tree| object. The new |Tree| will then be a structural clone of this argument.

**kwargs : keyword arguments, optional The following optional keyword arguments are recognized and handled by this constructor:

    <code>label</code>
        The label or description of the new |Tree| object.
    <code>taxon\_namespace</code>
        Specifies the |TaxonNamespace| object to be
        that the new |Tree| object will reference.

Examples

Tree objects can be instantiated in the following ways::

# /usr/bin/env python

try:
    from StringIO import StringIO
except ImportError:
    from io import StringIO
from dendropy import Tree, TaxonNamespace

# empty tree
t1 = Tree()

# Tree objects can be instantiated from an external data source
# using the 'get()' factory class method

# From a file-like object
t2 = Tree.get(file=open('treefile.tre', 'r'),
                schema="newick",
                tree_offset=0)

# From a path
t3 = Tree.get(path='sometrees.nexus',
        schema="nexus",
        collection_offset=2,
        tree_offset=1)

# From a string
s = "((A,B),(C,D));((A,C),(B,D));"
# tree will be '((A,B),(C,D))'
t4 = Tree.get(data=s,
        schema="newick")
# tree will be '((A,C),(B,D))'
t5 = Tree.get(data=s,
        schema="newick",
        tree_offset=1)
# passing keywords to underlying tree parser
t7 = dendropy.Tree.get(
        data="((A,B),(C,D));",
        schema="newick",
        taxon_namespace=t3.taxon_namespace,
        suppress_internal_node_taxa=False,
        preserve_underscores=True)

# Tree objects can be written out using the 'write()' method.
t1.write(file=open('treefile.tre', 'r'),
        schema="newick")
t1.write(path='treefile.nex',
        schema="nexus")

# Or returned as a string using the 'as_string()' method.
s = t1.as_string("nexml")

# tree structure deep-copied from another tree
t8 = dendropy.Tree(t7)
assert t8 is not t7                             # Trees are distinct
assert t8.symmetric_difference(t7) == 0         # and structure is identical
assert t8.taxon_namespace is t7.taxon_namespace             # BUT taxa are not cloned.
nds3 = [nd for nd in t7.postorder_node_iter()]  # Nodes in the two trees
nds4 = [nd for nd in t8.postorder_node_iter()]  # are distinct objects,
for i, n in enumerate(nds3):                    # and can be manipulated
    assert nds3[i] is not nds4[i]               # independentally.
egs3 = [eg for eg in t7.postorder_edge_iter()]  # Edges in the two trees
egs4 = [eg for eg in t8.postorder_edge_iter()]  # are also distinct objects,
for i, e in enumerate(egs3):                    # and can also be manipulated
    assert egs3[i] is not egs4[i]               # independentally.
lves7 = t7.leaf_nodes()                         # Leaf nodes in the two trees
lves8 = t8.leaf_nodes()                         # are also distinct objects,
for i, lf in enumerate(lves3):                  # but order is the same,
    assert lves7[i] is not lves8[i]             # and associated Taxon objects
    assert lves7[i].taxon is lves8[i].taxon     # are the same.

# To create deep copy of a tree with a different taxon namespace,
# Use 'copy.deepcopy()'
t9 = copy.deepcopy(t7)

# Or explicitly pass in a new TaxonNamespace instance
taxa = TaxonNamespace()
t9 = dendropy.Tree(t7, taxon_namespace=taxa)
assert t9 is not t7                             # As above, the trees are distinct
assert t9.symmetric_difference(t7) == 0         # and the structures are identical,
assert t9.taxon_namespace is not t7.taxon_namespace         # but this time, the taxa *are* different
assert t9.taxon_namespace is taxa                     # as the given TaxonNamespace is used instead.
lves3 = t7.leaf_nodes()                         # Leaf nodes (and, for that matter other nodes
lves5 = t9.leaf_nodes()                         # as well as edges) are also distinct objects
for i, lf in enumerate(lves3):                  # and the order is the same, as above,
    assert lves7[i] is not lves9[i]             # but this time the associated Taxon
    assert lves7[i].taxon is not lves9[i].taxon # objects are distinct though the taxon
    assert lves7[i].taxon.label == lves9[i].taxon.label # labels are the same.

# to 'switch out' the TaxonNamespace of a tree, replace the reference and
# reindex the taxa:
t11 = Tree.get(data='((A,B),(C,D));', 'newick')
taxa = TaxonNamespace()
t11.taxon_namespace = taxa
t11.reindex_subcomponent_taxa()

# You can also explicitly pass in a seed node:
seed = Node(label="root")
t12 = Tree(seed_node=seed)
assert t12.seed_node is seed

Ancestors

  • dendropy.datamodel.treemodel._tree.Tree
  • dendropy.datamodel.taxonmodel.TaxonNamespaceAssociated
  • dendropy.datamodel.basemodel.Annotable
  • dendropy.datamodel.basemodel.Deserializable
  • dendropy.datamodel.basemodel.NonMultiReadable
  • dendropy.datamodel.basemodel.Serializable
  • dendropy.datamodel.basemodel.DataObject

Static methods

def find_closest_leaf_node(node: dendropy.datamodel.treemodel._node.Node) ‑> dendropy.datamodel.treemodel._node.Node

Find the leaf node that has the shortest path length to the given node.

Args

node
The node of interest.

Returns

The leaf node closest to the node of interest.

def from_disk(path: str,
schema: str = 'newick',
preserve_underscores: bool = True,
outgroup: str | None = None,
msa_path: str | None = None,
get_kwds: dict | None = None,
**kwds) ‑> Tree

Loads a tree from a file.

Args

path : str
Path to the file containing the tree.
schema : str
The schema of the tree file (e.g., "newick"). See dendropy.Tree.get for options.
preserve_underscores : bool
If True, preserve underscores in taxon labels.
outgroup : str, optional
The name of the taxon to use as the outgroup. Defaults to None.
msa_path : str, optional
Path to a FASTA file containing leaf sequences. Defaults to None.
get_kwds : dict, optional
Keyword arguments passed to dendropy.Tree.get. Defaults to None.
**kwds
Additional keyword arguments passed to add_sequences_to_tree.

Returns

Tree
The loaded tree object.

Instance variables

prop multiple_sequence_alignment

Generates a MultipleSequenceAlignment object from the tree.

Leaf nodes on the tree must have 'sequence' attributes and taxon labels.

Returns

MultipleSequenceAlignment
The generated alignment object.

Methods

def clade_bbox(self, taxon_labels: list[str]) ‑> dict[str, float]

Calculates the bounding box of a clade.

The bounding box is determined by finding the most recent common ancestor (MRCA) of the specified taxa and then calculating the minimum and maximum x and y coordinates of its child nodes.

Args

taxon_labels : list[str]
A list of taxon labels that define the clade.

Returns

dict[str, float]
A dictionary containing the coordinates of the bounding box with keys: 'min_x', 'max_x', 'min_y', 'max_y'.
def distance_between(self,
node1: dendropy.datamodel.treemodel._node.Node,
node2: dendropy.datamodel.treemodel._node.Node) ‑> float

Calculates the distance between two nodes.

The distance is calculated as the sum of the branch lengths along the path connecting the two nodes.

Args

node1 : dp.Node
The first node.
node2 : dp.Node
The second node.

Returns

float
The distance between the two nodes.
def internal_node_mrca(self,
node1: dendropy.datamodel.treemodel._node.Node,
node2: dendropy.datamodel.treemodel._node.Node) ‑> dendropy.datamodel.treemodel._node.Node

Finds the MRCA of two nodes.

Note

dendropy.tree.mrca only works on leaf nodes (or nodes with taxon labels).

Args

node1 : dp.Node
The first node.
node2 : dp.Node
The second node.

Returns

dp.Node
The MRCA of the two nodes.
def node_to_root_path(self, taxon: str | dendropy.datamodel.treemodel._node.Node) ‑> Generator[dendropy.datamodel.treemodel._node.Node, None, None]

Nodes from a taxon to the root node.

Args

taxon : str or dendropy.Node
The taxon label of the starting node, or the node object.

Yields

dp.Node
The nodes from the taxon to the root.
def plot_clade_bbox(self,
taxon_labels: list[str],
ax: matplotlib.axes._axes.Axes | None = None,
extend_right: float = 0.0,
extend_down: float = 0.0,
label: str | None = None,
label_kwds: dict | None = None,
**kwds)

Plots a rectangle around the bounding box of a clade.

Args

taxon_labels : list[str]
A list of taxon labels that define the clade.
ax : mp.axes.Axes, optional
The matplotlib axes to plot on. Defaults to None.
extend_right : float
Amount to extend the box to the right, in axes coordinates.
extend_down : float
Amount to extend the box down, in axes coordinates.
label : str, optional
A label to apply to the box. Defaults to None.
label_kwds : dict, optional
Keyword arguments passed to matplotlib.axes.Axes.text. Defaults to None.
**kwds
Additional keyword arguments passed to matplotlib.patches.Rectangle.

Returns

matplotlib.patches.Rectangle
The rectangle patch added to the axes.
def plot_tree_msa(self,
msa_plot_kwds: dict | None = None,
axes: tuple[matplotlib.axes._axes.Axes, matplotlib.axes._axes.Axes] | None = None) ‑> tuple[matplotlib.axes._axes.Axes, matplotlib.axes._axes.Axes]

Plots the tree and multiple sequence alignment.

Args

msa_plot_kwds : dict, optional
Keyword arguments passed to the multiple sequence alignment plot function. Defaults to None.
axes : tuple[mp.axes.Axes, mp.axes.Axes], optional
A tuple of two matplotlib axes to plot on. If None, new axes are created. Defaults to None.

Returns

tuple[mp.axes.Axes, mp.axes.Axes]
The matplotlib axes used for plotting.